About the Project

BOLD the Barcode of Life

What is a DNA barcode?

If you look closely at the side of the encasement on these works of art, you will see a series of A's, C's, G's and T's. They make up a DNA sequence, but not just any sequence—it is a sequence unique to this species. Each species has a different sequence at this particular spot in their DNA code. Scientists call this sequence fragment a "DNA barcode". See below for an example of a DNA barcode of a species in the exhibition.

DNA barcoding uses a small fragment of a single gene in an organism's DNA to identify the species to which that organism belongs, much like one might use a UPC barcode to distinguish different products. These powerful tools are helping scientists to catalogue the world's biodiversity. The process began in Guelph, Ontario, Canada, and scientists there continue to lead international work aiming to catalogue the earth's life forms completely.

Among the many applications of DNA barcoding is its use as an important tool in modern conservation biology. Indeed, conservation is at the very core of this work, which provides viewers with the opportunity to reflect on the impact of humankind on our environment.

BOLD utilizes two-dimensional codes to link the viewer to the science behind the art. By scanning one of QR codes, for example a fish collected in association with Dr. Meyer's BioCode Moorea project and now in Smithsonian Institute's collections, the viewer is transported to a story on this website about the coral reef ecosystem as told by scientists working on the project. All of the specimens portrayed in this series are deliberately fuzzy, thus making it difficult to discern if each organism is real or a counterfeit. Yet, adorning each BOLD sculpture is the barcode of the specimen that Rossano is trying to represent. The barcode is the reality, and the specimen, his creative manifestation, is the link to the science. With this series of artwork, BOLD, an acronym for the Barcode of Life Database, each specimen and its viewer is linked to the BOLD database, the same database that houses portions of the Smithsonian's digitized genetic collections.

Also encoded in these DNA sequences is both a shared and unique history that can be used to trace a specific organism through its evolutionary lineage. Those letters in common between organisms demonstrate a shared history, whereas those base pairs, where different, represent unique histories. It is this history and exploring intersections (common histories) between genetic barcodes from various regions of the planet that are of interest to me. From developing an understanding of the commonality among these vastly different environments, Rossano tells stories through his work that will inform and educate the audience to the marvels of science and the natural world, and to inspire them. By drawing these comparisons, viewers realize that even their backyards are connected to this global web of life.

ACCCTTTATTTAGTATTTGGCGCCTGAGCTGGAATAGTCGGGACTGCCCTGAGCCTCCTTATCCGAGCAGAGCTT
AGCCAACCAGGCGCACTGCTAGGGGATGACCAGATCTATAATGTAATTGTTACAGCCCACGCCTTCGTAATAATC
TTTTTTATAGTTATGCCCATCATGATTGGCGGTTTTGGAAACTGACTCATTCCCCTTATAATCGGAGCCCCCGAC
ATAGCATTCCCTCGAATGAACAACATGAGCTTTTGGCTTCTCCCACCATCCTTTCTTCTTCTGCTTGCCTCATCA
GGCGTAGAAGCTGGAGCAGGGACGGGATGAACAGTTTACCCCCCGCTAGCCGGGAATTTGGCCCATGCAGGAGCT
TCCGTCGACTTAACAATCTTTTCGTTACACCTTGCAGGGATCTCTTCGATCCTAGGAGCTATTAATTTTATCACA
ACAATTATTAATATAAAACCCCCTGCTATTTCGCAATATCAGACACCTCTATTTGTGTGGGCTGTTCTAATTACC
GCGGTTCTTCTGTTATTGTCCCTTCCCGTTCTTGCTGCTGGGATCACGATGCTCCTGACAGATCGTAATCTAAAT
ACCACATTTTTTGACCCCGCAGGCGGAGGTGACCCAATTCTTTATCAACACTTA